Sequencing at Genome Quebec

 

 The Sequencing Platform provides the following standard set of common primers free of charge:

 

T7

5 - TAATACGACTCACTATAGGG - 3

T3

5 - AATTAACCCTCACTAAAGGG - 3

SP6

5 - TATTTAGGTGACACTATAG - 3

M13 forward

5 - GTAAAACGACGGCCAGT - 3

M13 reverse

5 - GGAAACAGCTATGACCATG - 3

 

 You are required to provide all other sequencing primer(s) at a concentration of 20 uM. Please provide aliquots of 5 ul of primer for each sample to be sequenced with that primer in a separate tube. All unused DNA and/or primers will be kept for a maximum of two weeks after transmission of results. If 12 or more samples need to be sequenced with the same primer or if your primers are in limited amount, you may provide a single tube of primer for the sequencing of those samples. In such case there must be at least 1 ul of p[rimer for each sequencing reaction. Make sure that the samples are placed in a consecutive order on sample sheet (e.g. samples are positions B01 to B12).

 

All DNA samples must be sent in strip tubes or 96-well plates at concentration between 100 ng/ul and 500 ng/ul in a volume of 5-10 ul. (200uL PCR tubes are OK too.) This concentration is used as an approximation. You do not have to measure the concentration. We recommend that you verify quality and quantity of DNA samples by agarose gel electrophoresis. It is your responsibility to send templates of good quality and in sufficient amounts.

 

5. Send samples by mail or in person

 

 The samples can be sent to us by mail at the address shown below. You can also bring the samples in person on week days between 9 am and 5 pm.

 

 Please send samples to:

Pierre Lepage ou Corine Zotti

 McGill University and Genome Quebec Innovation Centre

 740 Dr. Penfield Ave

 Room 7300

 Montreal, QC

 H3A 1A4

 Tel: 514-398-3311, extension 00346# (PL) or 00522# (CZ).

 

The sample submission form for sequencing must be e-mailed to following E-mail address:  corine.zotti@mail.mcgill.ca

 

Check finished sequence at https://genomequebec.mcgill.ca/nanuqAdministration/

 

 User name:  jliu12

Password:    ask Ed